The difference between a clinical technician and clinical practitioner is in the scope of practice: the need for a bioscience understanding in paramedicine.

The difference between a clinical technician and clinical practitioner is in the scope of practice: the need for a bioscience understanding in paramedicine.

“Just teach me what I need to know!” It is usually heard refrain is often spoken by the student allied health for preclinical study science (physiology, anatomy, pharmacology). Here we use clinical scenarios carried out by the second year students Paramedic Practice Bachelor of acute coronary syndromes to show differences in clinical decision making when using clinical reasoning approach to treatment rather than relying exclusively on the approach practice guidelines.

We hope to show that understanding basic bioscience concepts, such as the Frank-Starling mechanism and anatomy and physiology of the autonomic nervous system, is the key to provide good clinical care in response to the patient’s symptoms ambiguous. Students who understand these concepts underlying the patient’s treatment guidelines they will make better clinical decisions and better provide quality care of students who follow the guidelines exclusively.

Our aim is a practical demonstration of the value of a detailed understanding of the human Bioscience in allied health education. As health care providers transition from the “technician” to “practitioner,” the key distinguishing feature of the role is the ability to practice independently, using “best judgment” rather than clinical guidelines (only). Evidence suggests that the management of complex cases require a detailed understanding of bioscience.


Volume 1, Issue 1 of the Mathematical Biosciences is a place for the now-classic paper on the application of the theory of a single disturbance in enzyme kinetics, “On the status of the mathematics of the hypothesis pseudo-steady state kinetics of biochemical” by FG ​​Heineken, HM Tsuchiya and R. Aris. More than 50 years have passed, but the paper continues to be studied and mined for insights.

This perspective discusses both the strengths and weaknesses of the work presented in this paper. For many people, the justification approach to pseudo-steady-state using a single interference theory is the main achievement of this paper. However, there is so much more material here, which laid the foundation for much of biochemistry research of mathematics in the intervening decades

 The difference between a clinical technician and clinical practitioner is in the scope of practice: the need for a bioscience understanding in paramedicine.
The difference between a clinical technician and clinical practitioner is in the scope of practice: the need for a bioscience understanding in paramedicine.

The Pacific Biosciences de novo assembled genomic dataset of parthenogenesis New Zealand wild populations longhorned ticks, Haemaphysalis longicornis Neumann, 1901.

longhorned tick, Haemaphysalis longicornis, feed on a variety of bird and mammal hosts. Mammalian hosts including cattle, deer, sheep, goats, humans and horses. This tick is known to transmit a number of pathogens that cause tick-borne diseases, and is a vector of a serious outbreak recently theileriosis oriental in New Zealand.

A New Zealand-USA consortium established to sequence, assemble, and annotate the genome of these fleas, use flea obtained from the New Zealand North Island. In New Zealand, the check is considered exclusive parthenogenesis and these properties are considered useful for genome assembly. molecular weight genomic DNA is very high and aligned on the Illumina platform HiSeq4000 long Sequel Bio Pac-read.

HDAC1 Immunoprecipitation (IP) & Activity Assay Kit

K342-25
EUR 865

Human Histone Deacetylase 3 (HDAC3) ELISA kit

DLR-HDAC3-Hu-48T 48T
EUR 516
  • Should the Human Histone Deacetylase 3 (HDAC3) ELISA kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histone Deacetylase 3 (HDAC3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Histone Deacetylase 3 (HDAC3) ELISA kit

DLR-HDAC3-Hu-96T 96T
EUR 673
  • Should the Human Histone Deacetylase 3 (HDAC3) ELISA kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histone Deacetylase 3 (HDAC3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Histone Deacetylase 3 (HDAC3) ELISA kit

RDR-HDAC3-Hu-48Tests 48 Tests
EUR 544

Human Histone Deacetylase 3 (HDAC3) ELISA kit

RDR-HDAC3-Hu-96Tests 96 Tests
EUR 756

Immunoprecipitation Kit (OKRA00051)

OKRA00051 1 kit
EUR 1040
Description: Description of target: ;Species reactivity: ;Application: ;Assay info: ;Sensitivity:

Topoisomerase II Immunoprecipitation Kit

TG1035 >50 analyses
EUR 548

Hdac3/ Rat Hdac3 ELISA Kit

ELI-27737r 96 Tests
EUR 886

EpiQuik Chromatin Immunoprecipitation (ChIP) Kit

P-2002 96 Reactions
EUR 904.05
Description: Ask the seller for details

EpiQuik Methylated DNA Immunoprecipitation Kit

P-2019 48 Reactions
EUR 889.55
Description: Ask the seller for details

Immunoprecipitation Kit: Protein A-Agarose

BS688 20Rxn, 20prep
EUR 202.25
  • Product category: Molecular Biology Kits/Protein - Purification/Immunoprecipitation (IP)

Immunoprecipitation Kit: Protein A-Sepharose

BS690 20Rxn, 20prep
EUR 197.9
  • Product category: Molecular Biology Kits/Protein - Purification/Immunoprecipitation (IP)

HDAC3 antibody

20R-2774 50 ug
EUR 281
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody  

21660-100ul 100ul
EUR 252

HDAC3 Antibody  

21660-50ul 50ul
EUR 187

HDAC3 Antibody

31216-100ul 100ul
EUR 252

HDAC3 Antibody

31216-50ul 50ul
EUR 187

HDAC3 antibody

70R-17706 50 ul
EUR 435
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody

70R-11943 100 ug
EUR 403
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody

70R-31225 100 ug
EUR 327
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody

6603-100
EUR 338

HDAC3 Antibody

6603-30T
EUR 146

HDAC3 antibody

70R-14137 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody

33400-100ul 100ul
EUR 252

HDAC3 Antibody

33400-50ul 50ul
EUR 187

HDAC3 Antibody

3603-100
EUR 316

HDAC3 Antibody

3603-30T
EUR 146

HDAC3 Antibody

32620-100ul 100ul
EUR 252

HDAC3 antibody

10R-2003 100 ul
EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody

10R-2004 100 ul
EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody

10R-10389 100 ug
EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 Antibody

48964-100ul 100ul
EUR 333

HDAC3 Antibody

48964-50ul 50ul
EUR 239

HDAC3 Antibody

1-CSB-PA002880
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

HDAC3 Antibody

1-CSB-PA004117
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HDAC3 Antibody

CSB-PA916163-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody

CSB-PA916163-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody

CSB-PA967736-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody

CSB-PA967736-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody

1-CSB-PA899967
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

HDAC3 Antibody

DF6862 200ul
EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

Hdac3 antibody

70R-8546 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Hdac3 antibody

HDAC3 antibody

70R-33611 100 ug
EUR 327
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Protein

E24006 50 µg
EUR 806.9
Description: fast delivery possible

HDAC3 Antibody

AF0733 200ul
EUR 304
Description: HDAC3 Antibody detects endogenous levels of HDAC3.

HDAC3 Antibody

AF5349 200ul
EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

AF6016 200ul
EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

BF0230 200ul
EUR 376
Description: HDAC3 antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

1-CSB-PA010239GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HDAC3 Antibody

1-CSB-PA010239LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, ChIP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

HDAC3 siRNA

20-abx919179
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDAC3 siRNA

20-abx919180
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDAC3 Antibody

ABF5349 100 ug
EUR 438

HDAC3 Antibody

ABF6016 100 ug
EUR 438

HDAC3 Antibody

ABD6862 100 ug
EUR 438

HDAC3 Antibody

ABF0733 100 ug
EUR 438

pOTB7-HDAC3

PVT18724 2 ug
EUR 231

anti-HDAC3

YF-PA15910 50 ul
EUR 363
Description: Mouse polyclonal to HDAC3

anti-HDAC3

YF-PA15911 100 ul
EUR 403
Description: Rabbit polyclonal to HDAC3

anti-HDAC3

YF-PA15912 100 ug
EUR 403
Description: Rabbit polyclonal to HDAC3

anti-HDAC3

YF-PA25204 50 ul
EUR 334
Description: Mouse polyclonal to HDAC3

anti-HDAC3

YF-PA25205 50 ul
EUR 334
Description: Mouse polyclonal to HDAC3

Coelenterazine ip

10116 50uG
EUR 114
Description: Minimum order quantity: 1 unit of 50uG

Coelenterazine ip

10116-1 1MG
EUR 725
Description: Minimum order quantity: 1 unit of 1MG

Coelenterazine ip

10116-2 250uG
EUR 259
Description: Minimum order quantity: 1 unit of 250uG

IP-10/ Rat IP- 10 ELISA Kit

ELA-E0371r 96 Tests
EUR 886

EpiQuik Hydroxymethylated DNA Immunoprecipitation (hMeDIP) Kit

P-1038 96 Reactions
EUR 1672.55
Description: reagents widely cited

EpiQuik Tissue Chromatin Immunoprecipitation (ChIP) Kit

P-2003 96 Reactions
EUR 904.05
Description: reagents widely cited

EpiQuik Tissue Methylated DNA Immunoprecipitation Kit

P-2020 48 Reactions
EUR 889.55
Description: The best epigenetics products

HDAC3 Monoclonal Antibody

27125-100ul 100ul
EUR 252

HDAC3 Monoclonal Antibody

27125-50ul 50ul
EUR 187

HDAC3 Rabbit pAb

A12542-100ul 100 ul
EUR 308

HDAC3 Rabbit pAb

A12542-200ul 200 ul
EUR 459

HDAC3 Rabbit pAb

A12542-20ul 20 ul
EUR 183

HDAC3 Rabbit pAb

A12542-50ul 50 ul
EUR 223

Hdac3 Blocking Peptide

33R-2222 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hdac3 antibody, catalog no. 70R-8546

HDAC3 Blocking Peptide

33R-10828 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HDAC3 antibody, catalog no. 70R-11943

HDAC3 Polyclonal Antibody

40996-100ul 100ul
EUR 252

HDAC3 Polyclonal Antibody

40996-50ul 50ul
EUR 187

HDAC3 Assay Kit

55R-1377 100 assays
EUR 693
Description: Assay Kit for detection of HDAC3 in the research laboratory

HDAC3 Blocking Peptide

DF6862-BP 1mg
EUR 195

Anti-HDAC3 Antibody

A00839 100ug/vial
EUR 294

HDAC3 antibody (Ser424)

70R-33610 100 ug
EUR 327
Description: Rabbit polyclonal HDAC3 antibody (Ser424)

HDAC3 (pS424) Antibody

abx010928-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

HDAC3 Blocking Peptide

AF0733-BP 1mg
EUR 195

HDAC3 Blocking Peptide

AF5349-BP 1mg
EUR 195

HDAC3 Blocking Peptide

AF6016-BP 1mg
EUR 195

HDAC3 Conjugated Antibody

C32620 100ul
EUR 397

HDAC3 Conjugated Antibody

C31216 100ul
EUR 397

HDAC3 Blocking Peptide

BF0230-BP 1mg
EUR 195

HDAC3-specific Antibody

abx233799-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

HDAC3 (pS424) Antibody

abx333379-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Polyclonal HDAC3 Antibody

AMM05315G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications:

Polyclonal HDAC3 Antibody

AMM05316G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications:

Monoclonal HDAC3 Antibody

AMM05317G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human HDAC3. The antibodies are raised in Mouse. This antibody is applicable in WB

HDAC3 cloning plasmid

CSB-CL010239HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1287
  • Sequence: atggccaagaccgtggcctatttctacgaccccgacgtgggcaacttccactacggagctggacaccctatgaagccccatcgcctggcattgacccatagcctggtcctgcattacggtctctataagaagatgatcgtcttcaagccataccaggcctcccagcatgacatgt
  • Show more
Description: A cloning plasmid for the HDAC3 gene.

HDAC3 Polyclonal Antibody

ABP51501-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424
  • Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody

ABP51501-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424
  • Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody

ABP51501-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424
  • Applications tips:
Description: A polyclonal antibody for detection of HDAC3 from Human, Mouse, Rat. This HDAC3 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HDAC3 around the non-phosphorylation site of S424

HDAC3 Polyclonal Antibody

A68305 100 µg
EUR 570.55
Description: reagents widely cited

HDAC3 Rabbit mAb

A19537-100ul 100 ul
EUR 410

HDAC3 Rabbit mAb

A19537-200ul 200 ul
EUR 571

HDAC3 Rabbit mAb

A19537-20ul 20 ul
EUR 221

HDAC3 Rabbit mAb

A19537-50ul 50 ul
EUR 287

HDAC3 Rabbit pAb

A2139-100ul 100 ul
EUR 308

HDAC3 Rabbit pAb

A2139-200ul 200 ul
EUR 459

HDAC3 Rabbit pAb

A2139-20ul 20 ul
EUR 183

HDAC3 Rabbit pAb

A2139-50ul 50 ul
EUR 223

HDAC3 Mouse mAb

A2603-100ul 100 ul
EUR 384

HDAC3 Mouse mAb

A2603-200ul 200 ul
EUR 554

HDAC3 Mouse mAb

A2603-20ul 20 ul Ask for price

HDAC3 Mouse mAb

A2603-50ul 50 ul
EUR 265

HDAC3 Rabbit pAb

A16462-100ul 100 ul
EUR 308

HDAC3 Rabbit pAb

A16462-200ul 200 ul
EUR 459

HDAC3 Rabbit pAb

A16462-20ul 20 ul
EUR 183

HDAC3 Rabbit pAb

A16462-50ul 50 ul
EUR 223

anti- HDAC3 antibody

FNab03798 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • IF: 1:50 - 1:200
  • IP: 1:50 - 1:200
  • ChIP: 1:20 - 1:100
  • Immunogen: histone deacetylase 3
  • Uniprot ID: O15379
  • Gene ID: 8841
  • Research Area: Epigenetics, Cardiovascular, Metabolism
Description: Antibody raised against HDAC3

HDAC3 Polyclonal Antibody

ES2500-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

HDAC3 Polyclonal Antibody

ES2500-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Anti-HDAC3 Antibody

PA1600 100ug/vial
EUR 334

Anti-HDAC3 Antibody

PA1600-1 100ug/vial
EUR 334

anti-HDAC3 (3E11)

LF-MA10133 100 ug
EUR 363
Description: Mouse monoclonal to HDAC3

anti-HDAC3 (7G6C5)

LF-MA30212 100 ul
EUR 537
Description: Mouse Monoclonal to HDAC3

anti-HDAC3 (3A7B5)

LF-MA30213 100 ul
EUR 537
Description: Mouse Monoclonal to HDAC3

Anti-HDAC3 antibody

PAab03798 100 ug
EUR 355

pENTR223-HDAC3 vector

PVT12125 2 ug
EUR 308

Anti-HDAC3 antibody

STJ114416 100 µl
EUR 277
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene.

Anti-HDAC3 antibody

STJ118902 100 µl
EUR 277

Anti-HDAC3 antibody

STJ29889 100 µl
EUR 393
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene.

Anti-HDAC3 antibody

STJ23930 100 µl
EUR 277
Description: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene.

Anti-HDAC3 antibody

STJ93479 200 µl
EUR 197
Description: Rabbit polyclonal to HDAC3.

Anti-HDAC3 antibody

STJ73163 100 µg
EUR 359

Anti-HDAC3 antibody

STJ98129 100 µl
EUR 234
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody

STJ98130 100 µl
EUR 234
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody

STJ98496 100 µl
EUR 234
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 antibody

STJ99157 200 µl
EUR 197
Description: Mouse monoclonal to HDAC3.

Anti-HDAC3 (2A3)

YF-MA16552 100 ug
EUR 363
Description: Mouse monoclonal to HDAC3

IP 10 antibody

20R-1784 100 ug
EUR 673
Description: Rabbit polyclonal IP 10 antibody

IP-10 Antibody

5200-100
EUR 387

IP-10 Antibody

5202-100
EUR 338

IP Lysis Buffer

AR0107 100mL
EUR 101

IP Receptor Antibody

20-abx133296
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

rHu IP-10

AK9082-0005 5µg Ask for price

Twenty-eight SMRT cells produce a total of 21.3 million reads were assembled by Canu in supercomputing node is provided with access to 12 TB of RAM, running continuously for more than 24 days. Dataset final assembly consists of 34 211 contigs with an average contig length of 215 205 bp. Quality was assessed by analysis of genome described BUSCO, the approach provides a quantitative measure for the quality of the assembled genome. More than 95% of BUSCO genes found in the genome assembled sets. Only 48 of the 1,066 genes BUSCO lost and only 9 are present in fragmented condition. Raw sequencing reads and contigs assembled / scaffold archived at the National Center for Biotechnology Information.

Leave A Comment